Performance of 18S rDNA helix E23 for phylogenetic relationships within and between the Rotifera-Acanthocephala clades
←
→
Transcription du contenu de la page
Si votre navigateur ne rend pas la page correctement, lisez s'il vous plaît le contenu de la page ci-dessous
C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
© 2000 Académie des sciences/Éditions scientifiques et médicales Elsevier SAS. Tous droits réservés
S0764446900012300/FLA
Taxonomy / Taxinomie
Performance of 18S rDNA helix E23 for
phylogenetic relationships within and between the
Rotifera–Acanthocephala clades
Anne Miquelisa, Jean-François Martinb, c, Evan W. Carsond, Guy Bruna, André Gillesa*
a
Laboratoire d’hydrobiologie, UPRES Biodiversité 2202, université de Provence, 1, place Victor-Hugo,
13331 Marseille, France
b
Laboratoire de systématique évolutive, UPRES Biodiversité 2202, université de Provence, 1, place Victor-
Hugo, 13331 Marseille, France
c
Rocky Mountain Biological Laboratory, Crested Butte, CO 81224, USA
d
Department of Biology, Arizona State University, Tempe, AZ 85287-1501, USA
Received 16 February 2000; accepted 19 June 2000
Communicated by André Adoutte
Abstract – The species diversity of the phylum Rotifera has been largely studied on the
basis of morphological characters. However, cladistic relationships within this group are
poorly resolved due to extensive homoplasy in morphological traits, substantial pheno-
typic plasticity and a poor fossil record. We undertook this study to determine if a
phylogeny based on partial 18S rDNA, which included the helix E23 of 18S rDNA
sequence, was concordant with established taxonomic relationships within the order
Ploimida (class: Monogononta). We also estimated the level of polymorphism within
clones and populations of Ploimida ‘species’. Finally, we included the Cycliophora
Symbion pandora as outgroup and the variable helix E23 region to examine the influence
of their signal on the evolutionary relationships among Acanthocephala, Bdelloidea and
Ploimida. Phylogenetic reconstruction was performed using maximum parsimony, neigh-
bour joining and maximum likelihood methods. We found 1) that morphologically
similar Ploimida ‘species’ show vastly different 18S E23 rDNA sequences; 2) inclusion of
the helix E23 of 18S rDNA and its secondary structure analysis results in better resolution
of family level relationships within the Ploimida; 3) an impact of Symbion pandora as an
outgroup with inclusion of the helix E23 on the relationships between the Rotifera and
the Acanthocephala; and 4) partial incongruence and differential substitution rate
between conserved region and helix E23 region of the 18S rDNA gene depending on the
taxomic group studied. © 2000 Académie des sciences/Éditions scientifiques et médi-
cales Elsevier SAS
Rotifera / Acanthocephala / 18S rDNA / Ploimida systematic / substitution rate
Résumé – Performance de l’hélice E23 du 18S ADNr pour les relations phylogé-
nétiques entre et au sein du clade Rotifera-Acanthocephala. L’étude de la diver-
sité spécifique des rotifères a longtemps reposé sur l’analyse des caractères morpholo-
giques. Or, l’existence d’homoplasie au sein de ces caractères ainsi que l’importante
plasticité phénotypique et la rareté des fossiles ne permettent qu’une faible résolution
des relations phylogénétiques au sein de ce groupe. Notre étude a été réalisée afin de
confronter une phylogénie basée sur une portion du 18S ADNr (incluant l’hélice E23,
région variable) avec les relations taxinomiques préalablement définies sur la base des
* Correspondence and reprints: andre_gilles@hotmail.com
925A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
caractères morphologiques au sein de l’ordre des Ploimida (classe des Monogononta).
Nous avons, en outre, estimé le degré de polymorphisme entre clones et populations
« d’espèces » de Ploimida. Enfin, nous avons utilisé le Cycliophora Symbion pandora
comme groupe extérieur et nous avons inclus l’hélice E23, région variable, afin
d’examiner leur influence respective sur les relations phylogénétiques entre Acantho-
cephala, Bdelloidea et Ploimida. Les méthodes du « maximum de parcimonie », du
« neighbor joining » et du « maximum likelihood » ont été utilisées dans le cadre des
reconstructions phylogénétiques. Nous avons trouvé 1) que les « espèces» de Ploimida
morphologiquement identiques ont des séquences de 18S ADNr différentes ; 2) que
l’inclusion de l’hélice E23 du 18S ADNr et son analyse en structure bidimensionnelle
permettent de réincorporer l’information qu’elle contient, entraînant ainsi une meilleure
résolution des relations entre familles au sein des Ploimida ; 3) que le groupe extérieur
Symbion pandora et l’inclusion de l’hélice E23 ont un impact majeur sur les relations
entre rotifères et acanthocéphales ; et 4) qu’il y a une incongruence partielle ainsi que
des taux de substitution différents entre région conservée et hélice E23 au sein du 18S
ADNr suivant le groupe taxonomique étudié. © 2000 Académie des sciences/Éditions
scientifiques et médicales Elsevier SAS
Rotifera / Acanthocephala / 18S ADNr / systématique des Ploimida / taux de substitution
Version abrégée tions 1 à 186 et C2 = positions 432 à 500) ainsi qu’une
région variable (hélice E23 = positions 187 à 431). Trois
méthodes d’analyse sont utilisées : le neighbor-joining
Les 2 000 espèces constituant le phylum des Rotifera
(NJ), le maximum de parcimonie (MP) et le maximum
sont réparties en trois classes : Monogononta, Bdelloi-
de vraisemblance (ML pour Maximum Likelihood en
dea et Seisonidea. Malgré l’existence de nombreuses
anglais). Différentes méthodes sont utilisées pour tester
données morphologiques, ultrastructurales et allozymi-
la topologie des arbres et la robustesse des nœuds.
ques, les relations phylogénétiques ne sont que faible-
ment résolues dans ce groupe. Or, de récentes études La composition en bases des Ploimida est faiblement
de phylogénie moléculaire réalisées au sein des Aschel- biaisée (A+T = 56,41 %), mais aucune différence signi-
minthes suggèrent l’existence d’un clade Rotifera- ficative n’est observée entre les espèces. Le taux de
Acanthocephala. D’autres analyses moléculaires font divergence des séquences de 18S ADNr des différents
des acanthocephales un sous taxon des rotifères. genres de Ploimida peut atteindre 5 %. L’utilisation de
La présente étude basée sur l’utilisation d’une por- la structure secondaire du 18S ADNr montre que les
tion de 500 pb du 18S ADNr a pour but d’analyser les substitutions prédominent dans l’hélice E23. Le taux de
variations génétiques au sein de ce groupe. Cela inclut transitions par rapport aux transversions diminue rapi-
une estimation du taux de polymorphisme observé dement avec l’augmentation de la divergence molécu-
entre clones et populations appartenant à l’ordre des laire totale, cependant aucun effet de saturation n’est
Ploimida (classe des Monogononta) ainsi que, la défi- observé entre les différents profils de substitution. Afin
nition des relations existant entre Bdelloidea, Ploimida de tester l’influence des régions conservées et de
et Acanthocephala. Nous incluons dans l’analyse l’hélice l’hélice E23 sur la reconstruction phylogénétique, ces
E23, région variable du 18S ADNr et nous utilisons parties sont analysées séparément puis conjointement.
comme groupe extérieur le Cycliophora Symbion pan- Pour la région conservée (nucléotides 1 à 186 et 432
dora. à 500), seules 62 positions sont informatives. La valeur
Les Ploimida sont prélevés dans différents habitats du g1 est de –1,175, ce qui indique que ce jeu de
dans le sud-est de la France. Après identifications données contient un signal phylogénétique significatif.
réalisées sur la base de caractères morphologiques, Les valeurs du IC (indice de cohérence) et du IR (indice
cinq espèces representées par dix clones issus chacun de rétention) sont respectivement de 0,762 et 0,836,
d’une femelle parthénogénétique sont cultivés en labo- indiquant un faible taux d’homoplasie. Le test du taux
ratoire. L’ADN total de tous ces Ploimida est ensuite de vraisemblance montre que les topologies obtenues
extrait et un fragment de 500 pb du 18S ADNr est alors par chacune des trois méthodes d’analyses (MP, NJ et
amplifié par PCR. Les huit séquences d’acanthocépha- ML) ne sont pas significativement différentes.
les, ainsi que celles du Bdelloidea, de deux autres Pour l’hélice E23 (nucléotides 187 à 431), 127 sites
Ploimida et du Cycliophora proviennent de GenBank. sont informatifs pour la parcimonie. Les valeurs de IC
Les séquences sont alignées manuellement puis com- et de IR sont respectivement de 0,716 et 0,792. Les trois
parées en structure secondaire. Cette procédure per- méthodes d’analyse donnent là encore des topologies
met de localiser deux portions conservées (C1 = posi- ne présentant pas de différence significative. On
926A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
observe pour cette région variable une plus grande plus grande que celle des regions conservées pour la
homogéneité, des longueurs de branche entre les résolution des genres de Ploimida. Nous observons
groupes, que celle obtenue avec les parties conservées. également que l’hélice E23 et les régions conservées
Si on considère l’intégralité de la portion du 18S n’évoluent pas au même taux aussi bien à l’intérieur
ADNr séquencée (nucleotides 1 à 500), le test d’homo- des groupes (Ploimida, Bdelloidea, et Acanthocephala)
généite des partitions indique une incongruence entre que entre eux, augmentant de ce fait l’hétérogéneite
région conservée (C1-C2) et hélice E23 (hE23). Un dans les longueurs de branches entre les différents
retrait itératif des taxa démontre que cette incon- taxa. Les régions conservées montrent une violation de
gruence est due à un manque de signal phylogénétique l’uniformité du taux de substitution plus grande que
dans la région conservée (C1-C2) chez les Ploimida celle observée dans la partie variable. Notre étude
mais pas chez les Acanthocephala. Ce manque de montre des résultats nouveaux et robustes sur les liens
signal phylogénétique n’est pas détecté par le g1. phylogénétiques entre Rotifera et Acanthocephala qui
Nous démontrons dans cette étude que, la suppres- redeviendraient deux clades distincts tout en restant
sion de l’hélice E23 n’est pas justifiée dans le cadre des groupes frères. Ces résultats demandent à être
d’une analyse des liens phylogénétiques entre Rotifera complétés par l’étude de nouveaux gènes nucleaires
et Acanthocephala. Nous démontrons, en outre, que afin de confirmer le fort signal phylogénétique conte-
l’hélice E23 contient une information phylogénétique nue dans l’hélice E23.
1. Introduction cephala. However, due to alignment difficulties, some of
these studies have excluded the variable helix E23 region
of 18S rDNA and obtained an unstable position of the
The phylum Rotifera contains approximately 2 000
Bdelloidea (Rotifera) [33, 34]. On the other hand, Garey et
aquatic, semi-aquatic and ectoparasitic species [1], which
al. [32, 35] obtained a stable position of the Bdelloidea
are divided into three classes: Monogononta, Bdelloidea
grouped with Acanthocephala but with a very long branch.
and Seisonidea [2]. Establishment of systematic relation-
Finally, Near et al. [36] analysed the phylogenetic rela-
ships within this phylum has been challenging due to high
tionships of the Acanthocephala by including no new
levels of phenotypic plasticity, asexual mode of reproduc-
rotifer species and no outgroup. So it was impossible for
tion (strict or not), succession of sibling species in the same
instance to confirm (or infirm) the monophyly of Rotifera.
environment over time [3, 4] and introgression between
Because the helix E23 may provide critical phylogenetic
species of the same group [5]. Several character sets have
information for resolving the position of the Bdelloidea,
been used to examine the phylogenetic relationships of
removal of this region may not be justified. Therefore, we
this group, including ultrastructure [6–12], mating behav-
have included the helix E23 to determine if its inclusion
iour [13–16] and allozymes [3, 17–19], yet relationships
increases phylogenetic resolution and we have chosen
among ‘species’ remain uncertain.
Symbion pandora (Cycliophora) as outgroup, a close rela-
Molecular phylogenetic studies of Aschelminthes have
tive of the Rotifera–Acanthocephala clade [37].
suggested a clade consisting of Rotifera and the endopara-
sitic phylum Acanthocephala [20, 21]. This clade contains
at least 1 150 endoparasitic species divided into three 2. Materials and methods
classes: Archiacanthocephala, Palaeacanthocephala and
Eoacanthocephala [22, 23]. Even though this relationship
2.1. Biological samples
has also been supported by morphological and compara-
tive ultrastructural studies, it is still controversial [24–31]. Rotifers of the order Ploimida were sampled from differ-
More recent molecular studies have even placed Acantho- ent habitats in southeast France (table I). Morphological
cephala within the Rotifera [32–35]. In order to gain a characters were measured for 30 individuals from each
better understanding of the evolution of Rotifera and Acan- clone (see below) to identify specimens to species [38].
thocephala, it is critical that the systematic position of the Ten clones descended from a single parthenogenetic
Bdelloidea be resolved with more certainty. female (for each of the five putative species), were main-
In this study, we used a 500-bp region of 18S rDNA to tained in 2 mL of low-mineral water at 17 °C under a
examine patterns of genetic variation within and among 15L/9D photoperiod. Food used for cultures were algal
various rotifer groups. This included estimation of levels of (Chlorella vulgaris and Dunaliella tertiolecta) or rotifer
polymorphism within clones and populations of the order (Brachionus angularis – clone from Saint-Gilles, France)
Ploimida (class: Monogononta), and reconstruction of rela- depending on natural diet. Frequent sub-cultures were
tionships among taxa within and between Ploimida, Bdel- made to prevent production of males. Exclusion of males
loidea and Acanthocephala. Earlier studies [32, 33] have prevented genetic recombination, which only occurs dur-
used this gene in an attempt to resolve the position of ing the sexual phase of the Monogononta life cycle [39].
Bdelloidea relative to other Rotifera and the Acantho- Rotifers were sampled within each clone at regular inter-
927A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Table I. List of species and Genbank accession numbers.
Specimen name Systematic position Sequence name Origin
Brachionus angularis Monogononta, Ploimida, Brachionidae B. angularis1 Rhône river
B. angularis2 Rhône river
Brachionus calyciflorus Monogononta, Ploimida, Brachionidae B. calyciflorus ‘Landre’ mere
Brachionus plicatilis1 Monogononta, Ploimida, Brachionidae B. plicatilis1 U29235
Brachionus plicatilis2 Monogononta, Ploimida, Brachionidae B. plicatilis2 U49911
Brachionus plicatilis3 Monogononta, Ploimida, Brachionidae B. plicatilis3 ‘Bolmon’ mere
Keratella quadrata1 Monogononta, Ploimida, Brachionidae K. quadrata1 ‘Grans’ pond
Keratella quadrata2 Monogononta, Ploimida, Brachionidae K. quadrata2 ‘Grans’ pond
Asplanchna priodonta1 Monogononta, Ploimida, Asplanchnidae A. priodonta1 ‘Grans’ pond
Asplanchna priodonta2 Monogononta, Ploimida, Asplanchnidae A. priodonta2 ‘Grans’ pond
Asplanchna priodonta3 Monogononta, Ploimida, Asplanchnidae A. priodonta3 ‘Grans’ pond
Asplanchna priodonta4 Monogononta, Ploimida, Asplanchnidae A. priodonta4 ‘Grans’ pond
Asplanchna priodonta5 Monogononta, Ploimida, Asplanchnidae A. priodonta5 ‘Grans’ pond
Synchaeta tremula1 Monogononta, Ploimida, Synchaetidae S. tremula1 ‘Grans’ pond
Synchaeta tremula2 Monogononta, Ploimida, Synchaetidae S. tremula2 ‘Grans’ pond
Synchaeta sp.1 Monogononta, Ploimida, Synchaetidae S. sp.1 ‘Grans’ pond
Synchaeta sp.2 Monogononta, Ploimida, Synchaetidae S. sp.2 ‘Grans’ pond
Philodina acuticornis Bdelloidea,Bdelloida, Philodinidae P. acuticornis U41281
Macracanthorhynchus ingens Archiacanthocephala, Oligacanthorhynchida, Oligacanthorhynchidae M. ingens AF001844
Moniliformis moniliformis Archiacanthocephala, Moniliformida, Moniliformidae M. moniliformis Z19562
Neoechinorhynchus pseudemydis Eoacanthocephala, Neoechinorhynchida, Neoechinorhynchidae N. pseudemydis U41400
Plagiorhynchus cylindraceus Palaeacanthocephala, Polymorphida, Plagiorhynchidae P. cylindraceus AF001839
Polymorphus altmani Palaeacanthocephala, Polymorphida, Polymorphidae P. altmani AF001838
Corynosoma enhydri Palaeacanthocephala, Polymorphida, Polymorphidae C. enhydri AF001837
Centrorhynchus conspectus Palaeacanthocephala, Polymorphida, Centrorhynchidae C. conspectus U41399
Echinorhynchus gadi Palaeacanthocephala, Echinorhynchida Echinorhynchidae E. gadi U88335
Symbion pandora Cycliophora S. pandora Y14811
vals, then placed in three successive 45-min baths to clear Fragments were directly sequenced from the purified PCR
the intestinal tract [40]. This procedure ensured that each products using an automated sequencer (Genome Express
individual used in subsequent analyses had an empty S.A.) and the PCR primers. Sequences were obtained from
digestive tract during final harvest (checked with 50× GenBank for the following taxa (see table I for accession
power dissecting scope), before being stored at –80 °C. codes): Bdelloidea (Philodina acuticornis), two Ploimida
Because the genus Asplanchna is carnivorous, individuals (Brachionus plicatilis1 and Brachionus plicatilis2), eight
were starved for 24 h prior to harvesting to minimize Acanthocephala and the Cycliophora (Symbion pandora).
genetic contamination from their rotifer food, B. angularis.
Suitable food for the Synchaetidae was not available for
culture; therefore, field collections of Synchaetidae spe-
cies (Synchaeta tremula, Synchaeta sp1 and Synchaeta
sp2) were made, individuals identified, and stored at
–80 °C.
2.2. Molecular data
For Ploimida individuals, total DNA was extracted
according to the method of Taberlet and Bouvet [41] and a
500-bp segment of 18S rDNA gene was amplified by
standard PCR techniques using the following primers: 5’
CCACATCCAAGGAAGGCAGCAGGC 3’ (forward) and 5’
CCCGTGTTGAGTCAAATTAA 3’ (reverse). Thermal cycle
parameters were as follows: 2 min at 92 °C (1 cycle); 15 s
at 92 °C, 45 s at 48 °C, 1 min 30 s at 72 °C (5 cycles); 15 s
at 92 °C, 45 s at 52 °C, 1 min at 72 °C (30 cycles); 7 min at
72 °C (1 cycle). A second, higher annealing temperature
of 52 °C was used for more stringent annealing conditions
when necessary. The PCR products were purified follow- Figure 1. Relationships of two distance measures with the proportion
ing the Gelase protocol (EpicentreT) and stored at –20 °C. of nucleotide differences (p distance) for the positions 1–500.
928A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
2.3. Data analysis Phylogenetic analyses were performed using three dif-
ferent methods: 1) the neighbour-joining (NJ) method [45]
All 18S rDNA sequences were aligned manually using based on a matrix of the Jukes and Cantor distance [46]
MUST [42] and compared with the secondary structure and the Jukes and Cantor distance with an estimation of
alignment [43]. Visualization of the secondary structure alpha parameter equal to 1.22; in Mega [47]. These two
was made using RNAviz [44], which allowed for identifi- distance measures showed similar relationships with the
cation of the three distinct regions described by Win- proportion of nucleotide differences (p distance) (figure 1);
nepenninckx et al. [21] and Garey et al. [32]: two con- 2) A cladistic approach following the maximum parsi-
served segments (C1 = positions 1 to 186 and C2 = 432 to mony (MP) criterion (Branch and bound search of PAUP*);
500), separated by a variable stretch corresponding to and 3) maximum likelihood (ML) framework was used to
helix E23 (helix E23 = positions 187 to 431). choose a model which best explains the data [48, 49].
Figure 2. Part of the secondary structure of the 18S rRNA gene of Brachionus plicatilis showing the complete helix E23. Nucleotides that are
polymorphic in Ploidmida are shown in bold.
929A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Table II. Position of substitutions for the different Ploimida clones. See figure 1 for the structural links (* represents a gap).
Figure 3. Saturation curves for transitions versus transversions (positions 1–500).
General time reversible with a gamma distribution was the groups, and the following statistics were computed: Brem-
best fit model, but the likelihood of this tree was not er’s decay index [53]; differences in topology between
significantly different to the tree obtained by the Felsen- trees were assessed by Templeton’s test (Wilcoxon sign-
stein’s method [50] using PAUP*. So, due to the computer rank tests [54]) and the likelihood ratio test [55]. Relative
time calculation, robustness of nodes was estimated by rate tests were conducted using Phyltest [56].
bootstrap with 100 replicates for ML analysis on Felsen-
stein’s method [50] (using FastDNAML version 1.0 [51],
1 000 replicates for NJ (using Mega) and 1 000 replicates
3. Results
for MP trees (heuristic search of PAUP* with ten random
3.1. Evolutionary patterns of 18S rDNA for Ploimida
additions of taxa and TBR branch-swapping).
Incongruence between partition based on conserved The Ploimida exhibited slight base composition bias in
and/or helix E23 of 18S rDNA sequences was assessed by A + T content (56.41%); however, there were no signifi-
the partition homogeneity test (PHT) [52] as implemented cant differences in individual nucleotide compositions
in PAUP* with alpha = 0.01 and 0.001. To test the robust- within or between species. Base frequencies (in percent)
ness of deep branches in the tree two constraint trees were were A: 26.7, C: 16.6, G: 27.0 and T: 29.7. Different
built, with each one defining monophyly for one of the genera within Ploimida show 18S rDNA sequences that
930A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
differ by up to 5% (appendix). For instance, the level of
differentiation (mean of pair-wise nucleotide differences
and standard error) within Brachionus plicatilis was very
low (0.0028 ± 0.0012, appendix), while it was very high
for the two clones of Keratella quadrata (0.0211 ± 0.0066,
appendix). For Synchaeta sp. (the only specimens not
cloned), levels of variation between the sequences were
0.09–1.7% (appendix). For Asplanchna priodonta, we
found considerable variation among the five clones, rang-
ing from 0.00422 to 0.0211. To ensure that this variation
was not due to genetic contamination, one or two addi-
tional amplifications were examined for each cloned speci-
men. These sequences were identical to the original in all
cases except B. angularis, where we found two different
sequences with a level of variation of 0.0063. Further-
more, no differences were found among sequences from
amictic females (i.e. produce diploid egg by mitosis),
males and mictic females of the K. quadrata1 clone,
indicating that no genetic recombination occurred during
cloning.
We also examined the variation in 18S sequences by
localizing substitutions with respect to secondary struc-
ture using the Vawter and Brown [57] nomenclature to
name the different structures. In Ploimida sequences, there
were 51 substitutions, one deletion in a loop region and
two insertions (B. plicatilis2 was used as reference for the
secondary structure). All these substitutions appear pre-
dominantly in the helix E23. We observed eight substitu-
tions (= 17.02%) in loops (47 bases) and twenty-seven
substitutions (= 10.03%) in stems (269 bases), three pairs
of which were compensational. The bulges (82 bases)
contained six substitutions (= 7.31%) and the ‘other’ (75
bases) showed eleven substitutions plus two nucleotide
insertions (= 17.33%). Only two multiple substitutions Figure 4. A. Ratio of transitions to transversions versus percentage
occurred in loops and three in stems (table II and figure 2). divergence for all pair-wise comparisons except those between iden-
In the C1 region 2.68% of the positions were phylogeneti- tical taxa (positions 1–500).
cally informative (number of informative positions/length B. For the conserved zone (positions 1–186 and 432–500).
of the region), 2.89% in C2, and 8.16% in the helix E23 C. For the helix E23 region (positions 187–431). Saturation curves for
transitions versus transversions (positions 1–500).
region. It can also be seen that all non-homoplasic sites are
located in the helix E23 region. Therefore, for the remain-
der of the study we partitioned the 500-bp segment of the for stem and A/T rich for the loops and ‘other’). Our
18S rDNA gene in conserved (C1–C2) and helix E23 (hE23) analysis of base composition revealed no significant dif-
regions. ferences between regions or taxa. The A + T bias in
Many studies have shown that stem, loop and bulge Ploimida was similar to that in Acanthocephala, Cyclio-
regions of the ribosomal DNA structure exhibit nearly phora and Bdelloidea. The ratio of transitions to transver-
equivalent rates of evolution [57], although structure- sions showed a rapid decline (figure 3) with increasing
associated biases in base composition do exist (G/C rich total molecular divergence, but no saturation effects were
Table III. Characteristics of the phylogenetic data from partial 18S rDNA sequences.
Segment Number Number CI RI g1 Parsimony Estimation of gamma
of trees of steps shape parameter*
Informative Other variable Constant
characters characters characters
hE23 11 395 0.72 0.79 –0.97 127 50 68 α = 2.69
C 1 + C2 24 181 0.76 0.84 –1.18 62 46 147 α = 0.99
C1 + C2 + hE23 236 592 0.71 0.79 –1.04 189 96 215 α = 1.22
* Yang-Kumar method 1996 [72].
931A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Figure 5. A. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the conserved region (positions 1–186 and 432–500) among 26 ‘species’ of Ploimida, Acanthocephala and Bdelloidea, with Cycliophora as an outgroup: using maximum parsimony (bootstrap value on the top left and branch length value at the bottom), neighbour joining on a matrix of the Jukes and Cantor model (middle bootstrap value) and maximum likelihood (right bootstrap value) on a matrix of the Jukes and Cantor model. The likelihood ratio test and Templeton’s test indicate that the three trees are not significantly different in topology so only the maximum parsimony tree is shown. The decay index value is in bold next to the nodes. observed between different substitution patterns (figure 4). 3.2. Phylogenetic analysis Therefore, the entire 500-bp segment of 18S rDNA was used to study phylogenetic relationships between Rotifera 3.2.1. Conserved region (nucleotides 1–186 and 432–500) and Acanthocephala, with Cycliophora as an outgroup. In order to test the influence of conserved regions and helix Of the 254 positions in the conserved region, only 62 E23 on phylogenetic reconstruction, we also analysed were informative for standard unweighted parsimony. The these regions separately (sequences descriptions are found g1 value was –1.175, suggesting that the 18S rDNA data in table II. set contains significant phylogenetic signal, and the CI 932
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. B. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the helix E23 (positions 187–431). The
likelihood ratio test and Templeton’s test indicate that the three trees are not significantly different in topology so we show only the maximum
parsimony tree.
(consistency index) and RI (retention index) (0.762 and or removal of Philodina acuticornis) produced no signifi-
0.836, respectively) indicated a low level of homoplasy cant difference in the internal structure of the Ploimida or
(table III). Acanthocephala. The unresolved topology in the Ploimida
The three tree-making methods (MP, NJ and ML) pro- is not surprising, as there are few parsimony informative
duced similar topologies, and the likelihood ratio test sites. In fact, all Ploimida species clustered into a basal
(LRT) shows that the three trees are statistically indistin- polytomy, except Brachionus calyciflorus and
guishable. These topologies all displayed a basal K. quadrata2, which apparently grouped together due to
dichotomy with Bdelloidea and Acanthocephala forming stochastic homoplasy.
one cluster and Ploimida forming a large, separate group
(figure 5.a). The statistical support for this branching pat- 3.2.2. Helix E23 (nucleotides 187–431)
tern is high (BP > 50 %; decay index = 11) but the branch There are 127 parsimony informative sites, which pro-
of the Bdelloidea is extremely long in comparison with the duce a tree (figure 5.b) with CI and RI values of 0.716 and
other taxa (46–69 steps in parsimony). However, separate 0.792, respectively (table III). The three methods produced
analyses conducted using maximum parsimony for similar topologies and the likelihood ratio test (LRT) did
Ploimida and Acanthocephala (using successive addition not reject the null hypothesis of topological congruence
933A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Table IV. Alpha values obtained from the test for incongruence of Farris et al. [52] implemented in Paup*
Partitions Number of C1/helix E23 C2/helix E23 C1/C2 C1/C2/helix E23
iterations
Total data set 100 0.010 0.060 0.540 0.010
1000 0.001 0.054 0.531 0.002
Ploimida + Acanthocephala 100 0.010 0.050 0.420 0.010
1000 0.007 0.039 0.398 0.003
Ploimida 100 0.110 0.010 0.230 0.020
1000 0.127 0.010 0.265 0.008
Ploimida + Bdelloidea 100 0.110 0.020 0.310 0.050
1000 0.138 0.017 0.336 0.011
Acanthocephala 100 0.250 0.820 1.000 0.620
1000 0.199 0.824 1.000 0.616
Acanthocephala + Bdelloidea 100 0.570 0.380 1.000 0.580
1000 0.583 0.367 1.000 0.564
Table V. Relative rate test (Takezaki et al. [73] implemented in Phyltest [56]). We used Symbiom pandora as outgroup.
C1 + C2** hE23*** C1 + C2 + hE23****
∆L = La – Lb Z value ∆L = La – Lb Z value ∆L = La – Lb Z value
Rotifera
Ploimida/Ploimida
B. plicatilis–K. quadrata –0.011 7 – –0.022 3 – –0.016 3 –
A. priodonta–B. plicatilis 0.011 3 – –0.013 1 – –0.013 0 –
S. tremula–B. plicatilis 0.003 8 – 0.005 1 – –0.000 9 –
A. priodonta–S. tremula 0.007 5 – –0.018 2 – –0.012 1 –
K. quadrata–S. tremula 0.015 5 – 0.017 2 – 0.017 3 –
K. quadrata–A. priodonta 0.023 0 * 0.035 4 – 0.029 4 *
Rotifera
Bdelloidea/other
P. acuticornis–Ploimida 0.231 2 * 0.174 7 * 0.224 5 *
P. acuticornis–Archiacanthocephala 0.191 7 * 0.148 8 – 0.186 1 *
P. acuticornis–Eoacanthocephala 0.150 8 * –0.020 5 – 0.096 6 –
P. acuticornis–Palaeacanthocephala 0.038 8 – –0.149 5 – –0.363 6 –
Rotifera
Ploimida/Acanthocephala
Ploimida–Archiacanthocephala –0.039 5 – –0.025 9 – –0.038 4 –
Ploimida–Eoacanthocephala –0.080 4 * –0.195 3 * –0.127 9 *
Ploimida–Palaeacanthocephala –0.192 4 * –0.324 2 * –0.260 9 *
Rotifera
Acanthocephala/Acanthocephala
Archiacanthocephala–Eoacanthocephala –0.040 9 – –0.169 3 * –0.089 5 *
Archiacanthocephala–Palaeacanthocephala –0.152 9 * –0.298 3 * –0.222 5 *
Eoacanthocephala–Palaeacanthocephala –0.112 0 * –0.129 – –0.133 0 *
1
* Indicates significant deviation at the null hypothesis (5 % level) from a constant rate molecular clock (–: Indicates non significant deviation);
**distance used: Juke and Cantor distance alpha = 0.99; ***distance used: Juke and Cantor distance alpha = 2.69; ****distance used: Juke and
Cantor distance alpha = 1.22.
among trees. Interestingly, we established for this region a
homogeneity in the branch lengths (figure 5.b) between The Bdelloidea representative clustered with Ploimida
the different groups. This pattern was due to a better in MP, NJ and ML trees. The Ploimida consists of four
uniformity of the rate of substitution for the whole data set monophyletic groups: Brachionus, Keratella, Synchætidae
than that obtained for the conserved regions alone (table and Asplanchnidae. Phylogenetic relationships between
V). B. angularis and B. calyciflorus indicate a paraphyletic
Acanthocephala are monophyletic and represented by grouping (figure 5.b). The position of Bdelloidea as a sister
the two distinct clades Archiacanthocephala- group of Ploimida was supported by a decay index of 9.
Eoacanthocephala and Palaeacanthocephala (figure 5.b). Similarly, monophyly of the class Monogononta is sup-
These relationships were highly supported in bootstrap ported (figure 5.b). Templeton’s test indicated that the
tests of MP, NJ and ML trees. Within Palaeacanthocephala, Bdelloidea position in the (Acanthocephala, (Bdelloidea,
there are clearly two orders: Echinorhynchida and Poly- Ploimida)) topology was significantly different from both a
morphida. Phylogenetic relationships within Polymor- ((Acanthocephala, Bdelloidea), Ploimida) topology and a
phida remained largely unresolved. (Acanthocephala, Bdelloidea, Ploimida) trichotomy. Suc-
934A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. C. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the conserved and helix E23 (positions
1–500).
cessive addition or removal of the three different groups Regardless of the phylogenetic inference method used,
did not change the internal topology of the remaining both the Rotifera and Acanthocephala were monophyl-
phyla. etic. There are, however, topological differences within
3.2.3. Conserved + helix E23 (nucleotides 1–500) groups, depending on the sequence segment used (i.e.
C1 + C2, hE23, C1 + C2 + hE23). We find that within Acan-
The partition homogeneity test (PHT) between con-
served (C1–C2) and helix E23 (hE23) segments of 18S thocephala, the main difference between trees based on
rDNA indicated incongruence between these two regions conserved regions and those based on the helix E23 is the
(table IV). By iteratively removing taxa, we observed that position of Eoacanthocephala. In this case, a combined
this incongruence was because of a lack of phylogenetic analysis produced a tree similar to that obtained using
signal in the Ploimida conserved region (C1–C2). There- only the helix E23 stretch (figure 5.b and c). In the case of
fore, we combine the two conserved stretches (C1 and C2) the order Ploimida, A. priodonta clones and the family
and helix E23 (hE23) to study the impact of the incongru- Synchaetidae are monophyletic; however, monophyly of
ence of these two regions (detected for the Ploimida) on the genus Brachionus is not supported. Interestingly, we
the topology and the branch length of the tree based on the observed that the helix E23 and conserved regions do not
whole data set. evolve at the same rate within and among Ploimida,
935A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. D. Strict consensus of the eleven most parsimonious trees (395 steps with a C.I. = 0.72 and a R.I. = 0.79) using the helix E23 (positions
187–431).
Bdelloidea and Acanthocephala (table V), increasing the study of Rotifera and Acanthocephala [32, 35]; but many
heterogeneity in the branch lengths between the different questions remain unanswered about Rotifera polyphyly
taxa (figure 5.e). The conserved regions show more viola- due to a possible long branch attraction to Bdelloidea. We
tion of rate uniformity than the more variable regions. have attempted to resolve these questions by analysing a
previously excluded helix E23 with the 18S rDNA. We
also used the helix E23 to address family level relation-
4. Discussion ships of the Ploimida (Rotifera) and ordinal and familial
relationships of the Acanthocephala.
Species determination and phylogenetic reconstruction
of Ploimida–Bdelloidea–Acanthocephala has been a chal- 4.1. Differentiation in Ploimida clones
and phylogenetic utility of 18S rDNA for Ploimida
lenge due to: 1) high levels of morphological homoplasy
among extant species [1, 22]; and 2) a scarcity of posi- The extensive 18S rDNA polymorphism observed in
tively identified fossil Rotifera [58–60]. Therefore, molecu- clones for different Ploimida species (Asplanchna sp.,
lar phylogenetics provides an additional avenue of Keratella sp., Brachionus sp., Synchæta sp.) is in agree-
research. This approach has been used previously in the ment with previous findings from allozyme [3, 17–19],
936A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. E. Bootstrap analyses carried out with 1 000 iterations using neighbour joining on a matrix of the Jukes and Cantor model with gamma
shape parameter α = 1.22 for the conserved and helix E23 (positions 1–500).
genetic [61, 62] and morphological studies ([63], Rougier, mentation, though doing so was not necessary for the
pers. comm.). Also, a strict consensus of the eleven most purposes of this study since this divergence within the
parsimonious trees (figure 5.d) indicated a Brachionidae clone did not affect the tree topology.
clade (Brachionus + Keratella) closely related to the Syn-
chaetidae. This clade was the sister group of the A. pri- While phylogenies based on the helix E23 and con-
odonta clones. The existence of the Brachionidae clade is served plus helix E23 regions were consistent with the
not surprising since the genus Keratella has traditionally accepted relationships, only those based on the helix E23
been included within the Brachionidae family (Keratella region had high bootstrap support. The weakly supported
was originally considered to be in a distinct family due to nodes (based on conserved plus helix E23 regions) could
absence of a foot, but this distinction was considered too result from non-constant rates of evolution within and
tenuous to warrant classification as a separate family [64]). among families (table V), and between conserved and
However, these results have bootstrap support only in helix E23 regions. The high disparity of evolutionary rates
neighbour joining. Brachionus and Keratella were found was observed in the foraminifera for which an extreme
in a polytomy with Synchaeta and Asplanchna in parsi- difference was found in rates of molecular evolution [65].
mony. The observed variation in rates of evolution could be
We found an unexpected 18S sequence difference erroneous if some species in Ploimida are actually more
between two sequences of 18S rDNA from the same closely related to basal taxa than to other Ploimida; how-
cloned B. angularis individual (0.00634). This result is ever, this would suggest that well-supported topologies
easily reproduced experimentally and may be due to based on the helix E23, as well as results from morpho-
hybridization or ancestral polymorphism. Distinguishing logical, allozyme and other genetic studies, are all grossly
between these possibilities would require further experi- and concordantly incorrect.
937A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. F. Bootstrap analyses carried out with 1 000 iterations using neighbour joining on a matrix of the Jukes and Cantor model with gamma
shape parameter α = 2.69 for the conserved and helix E23 (positions 187–431).
4.2. Systematics of Acanthocephala 4.3. Systematic position of Bdelloidea and Rotifera–
Acanthocephala relationships
Regardless of the data subset used for phylogenetic
reconstruction (hE23, C1 + C2 + hE23), our results were We have demonstrated that removal of the helix E23 is
consistent with the monophyly of Acanthocephala and not justified because it is useful in reconstructing system-
monophyly of two of the three currently recognized acan- atic relationships within both Rotifera and Acantho-
thocephalan classes (the third class, Eoacanthacephala, cephala, as separate analysis of the helix E23 provided
was only represented by one species). Thus, greater phy- better intra-group resolution for Ploimida and Acantho-
logenetic resolution was obtained with molecular data cephala than that obtained by analysis of the conserved
when the sequence from the helix E23 region was included, regions alone. We observed that the helix E23 and con-
as opposed to the sequence from conserved regions alone. served regions do not evolve at the same rate within and
Inclusion of the helix E23 region still did not provide high among Ploimida, Bdelloidea and Acanthocephala (table
bootstrap support for inter-family relationships within the V, figure 5.e and f), inducing an heterogeneity in the
order Polymorphida (samples for the other orders con- branch lengths between these three groups when we
sisted of only one or two families). However, our topology combine the two regions. The fact that no saturation
was in general agreement with that of Near et al. [36], in effects were observed between different substitution pat-
which high bootstrap support was found for these relation- terns (figure 4) removes the possibility of an artefact in the
ships by using the complete 18S rDNA sequence. estimation of the substitution rate [66]. In this case using
938A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Appendix. Pairwise comparisons of nucleotide divergences (below the diagonal) and standard errors estimated according to p-distance (above the diagonal) for the different Ploimida clones
analysed.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
[1] Brachionus plicatilis1 0.002 1 0.003 0 0.008 8 0.008 6 0.008 3 0.006 3 0.005 2 0.005 9 0.006 9 0.007 2 0.007 5 0.006 9 0.007 8 0.008 6 0.008 6
[2] Brachionus plicatilis2 0.002 1 0.002 1 0.008 5 0.008 3 0.008 1 0.005 9 0.004 7 0.005 5 0.006 6 0.006 9 0.007 2 0.006 6 0.007 5 0.008 3 0.008 3
[3] Brachionus plicatilis3 0.004 2 0.002 1 0.008 8 0.008 1 0.007 8 0.005 6 0.004 2 0.005 9 0.006 3 0.007 2 0.007 5 0.006 9 0.007 8 0.008 0 0.008 0
[4] Keratella quadrata1 0.038 1 0.035 9 0.038 0 0.006 6 0.009 7 0.008 8 0.008 1 0.007 8 0.008 3 0.008 8 0.008 5 0.008 5 0.008 8 0.009 9 0.009 7
[5] Keratella quadrata2 0.036 0 0.033 8 0.031 7 0.021 1 0.007 8 0.007 5 0.007 2 0.007 5 0.007 8 0.008 1 0.008 6 0.008 3 0.008 6 0.009 0 0.009 0
[6] Brachionus calyciflorus 0.034 0 0.031 8 0.029 7 0.046 6 0.029 7 0.007 0 0.006 6 0.008 3 0.008 6 0.008 8 0.009 5 0.009 5 0.009 9 0.009 7 0.010 3
[7] Brachionus angularis1 0.019 1 0.016 9 0.014 8 0.038 1 0.027 5 0.023 4 0.003 7 0.005 9 0.006 3 0.006 6 0.007 5 0.007 5 0.007 8 0.008 6 0.008 1
[8] Brachionus angularis2 0.012 7 0.010 6 0.008 5 0.031 7 0.025 4 0.021 2 0.006 3 0.004 7 0.005 1 0.006 3 0.006 6 0.006 6 0.007 5 0.007 8 0.007 8
[9] Synchaeta sp.1 0.016 9 0.014 8 0.016 9 0.029 5 0.027 5 0.033 9 0.016 9 0.010 6 0.003 6 0.004 2 0.004 7 0.005 5 0.006 6 0.007 5 0.007 5
[10] Synchaeta tremula1 0.023 3 0.021 1 0.019 0 0.033 8 0.029 6 0.036 0 0.019 0 0.012 7 0.006 3 0.004 7 0.005 9 0.006 6 0.007 5 0.007 8 0.007 8
[11] Synchaeta tremula2 0.025 4 0.023 2 0.025 3 0.038 0 0.031 7 0.038 1 0.021 1 0.019 0 0.008 4 0.010 5 0.006 3 0.006 9 0.007 8 0.008 5 0.008 5
[12] Synchaeta sp.2 0.027 5 0.025 3 0.027 4 0.035 9 0.035 9 0.044 5 0.027 5 0.021 1 0.010 5 0.016 9 0.019 0 0.007 2 0.008 0 0.008 8 0.008 3
[13] Asplanchna priodonta1 0.023 3 0.021 1 0.023 2 0.035 9 0.033 8 0.044 5 0.027 5 0.021 1 0.014 8 0.021 1 0.023 2 0.025 3 0.003 6 0.005 1 0.005 1
[14] Asplanchna priodonta 2 0.029 6 0.027 4 0.029 5 0.038 0 0.035 9 0.048 7 0.029 6 0.027 5 0.021 1 0.027 4 0.029 5 0.031 6 0.006 3 0.006 3 0.005 5
[15] Asplanchna priodonta3 0.035 9 0.033 8 0.031 6 0.048 5 0.040 2 0.046 6 0.035 9 0.029 6 0.027 4 0.029 5 0.035 9 0.038 0 0.012 7 0.019 0 0.006 6
[16] Asplanchna priodonta4 0.035 9 0.033 8 0.031 6 0.046 4 0.040 2 0.053 0 0.031 7 0.029 6 0.027 4 0.029 5 0.035 9 0.033 8 0.012 7 0.014 8 0.021 1
[17] Asplanchna priodonta5 0.027 5 0.025 3 0.027 4 0.040 1 0.038 1 0.048 7 0.031 7 0.025 4 0.019 0 0.025 3 0.027 4 0.029 5 0.004 2 0.010 5 0.016 9 0.012 7
939A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
the complete 18S rDNA without congruence test between time scales. However, we found that exclusion of the helix
the regions could involve a long branch attraction phe- E23 region introduces limitations to reconstruction of intra-
nomenon [67, 68]. Nevertheless, there was still sufficient phylum relationships in the Rotifera. Consideration of only
phylogenetic signal to allow reconstruction of evolution- conserved regions tends to produce basal polytomies,
ary relationships within Acanthocephala but this phyloge- compromising resolution of phyla-level relationships. Fur-
netic signal decreased within Ploimida. Compared to a thermore, combination of the helix E23 region with the
strict consensus between incongruent data sets (conserved conserved region increases the resolution within the Acan-
versus helix E23), a combination of regions provided thocephalans. Unfortunately, it is not the case for the
greater resolution at the inter- and intra-phylum levels. Rotifers, for which some incongruence was detected
However, this procedure was not free of drawbacks. When between these two regions. On the other hand, even if
helix E23 and conserved regions were combined, it was sites that have experienced an inordinate number of sub-
not possible to resolve the intra-Ploimida phylogeny, pos- stitutions are eliminated, weak resolution still results due
sibly due to dilution of phylogenetic signal contained in to unintended removal of informative sites [34]. Our results
the helix E23 by inclusion of homoplasic positions located indicate that resolution of Rotifera, Bdelloidea and Acan-
in conserved regions (this incongruence is well detected thocephala inter-relationships will require analysis of addi-
by the partition homogeneity test, table V). tional nuclear genes, such as hox cluster [70, 71], to
corroborate the validity of the phylogenetic signal con-
tained in the helix E23 region which has provided robust
5. Conclusion inference of within-phylum relationships of the Rotifera–
Acanthocephalan clades.
Several studies addressing Metazoan relationships with
18S rDNA have only used conserved regions because of
ambiguities encountered in aligning the helix E23 region Acknowledgements. We thank N. Angeli, P. Clément,
at high taxonomic level [21, 33, 37, 69]. This approach C. Cunningham, J. Deutsch, J.-L. d’Hondt, T.E. Dowl-
has also been considered warranted since conserved ing, S. Gadagkar, S. Kumar, H. Philippe, R. Pourriot, C.
regions are generally considered less subject to saturation Rougier, C. Secor and A. Vaquer for useful comments
than the faster evolving helix E23, which would have and/or technical support. We are grateful to J. Garey for
accumulated greater levels of saturation over such long sending us a preprint.
References [11] Clément P., Wurdak E., Rotifera, in: Harrison F.W., Ruppert E.E.
(Eds.), Microscopic Anatomy of Invertebrates, Vol.4: Aschelminthes,
Wiley-Liss Inc, 1991, pp.219–296.
[12] Ahlrichs W.H., Epidermal ultrastructure of Seison nebalia and
[1] Nogrady T., Wallace R.L., Snell T.W., Rotifera Vol. 1: Biology,
Seison annulatus, and a comparison of epidermal structures within the
ecology and systematics, in: Guides of the Identification of the Microin-
Gnathifera, Zoomorphology 117 (1997) 41–48.
vertebrates of the Continental Waters of the World, SPB Academic Pub-
lishing, The Hague, The Netherlands, 1993. [13] Snell T.W., Hawkinson C.A., Behavioral reproductive isolation
among populations of the rotifer Brachionus plicatilis, Evolution 37 (1983)
[2] Wallace R.L., Snell T.W., Rotifera, in: Ecology and Classification of
1294–1305.
North American Freshwater Invertebrates, Academic Press, Inc., 1991,
pp. 187–248. [14] Rico-Martinez R., Snell T.W., Mating behavior and mate recogni-
tion pheromone blocking of male receptors in Brachionus plicatilis Müller
[3] Gomez A., Temprano M., Serra M., Ecological genetics of a cyclical (Rotifera), Hydrobiologia 313/314 (1995) 105–110.
parthenogen in temporary habitats, J. Evol. Biol. 8 (1995) 601–622.
[15] Gomez A., Serra M., Mate choice in male Brachionus plicatilis
[4] Serra M., Galiana A., Gomez A., Speciation in Monogonont roti- rotifers, Funct. Ecol. 10 (1996) 681–687.
fers, Hydrobiologia 358 (1997) 63–70.
[16] Rico-Martinez R., Snell T.W., Mating behavior in eight rotifer
[5] Pejler B., Introgression in planktonic Rotatoria with some points of species: using cross-mating tests to study species boundaries, Hydrobio-
view on its causes and conceivable results, Evolution 10 (1956) 246–261. logia 356 (1997) 165–173.
[6] Clément P., Ultrastructural research on Rotifers, Arch. Hydrobiol. [17] Fu Y., Hirayama K., Natsukari Y., Genetic divergence between S
Beih. Ergebn. Limnol. 8 (1977) 270–297. and L type strains of the rotifer Brachionus plicatilis O.F. Müller, J. Exp.
[7] Clément P., Phylogenetic relationships of Rotifers as derived from Mar. Biol. Ecol. 151 (1991) 43–56.
photoreceptor morphology and other ultrastructural analyses, in: [18] Hagiwara A., Kotani T., Snell T.W., Assava-Aree M., Hirayama K.,
Dumont H.J., Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Morphology, reproduction, genetics, and mating behavior of small, tropi-
Dr W, Junk Publishers, The Hague, 1980, pp. 93–117. cal marine Brachionus strains (Rotifera), J. Exp. Mar. Biol. Ecol. 194 (1995)
[8] Clément P., Amsellem J., Cornillac A.M., Luciani A., Ricci C., 25–37.
Ultrastructural approach to feeding behaviour in Philodina roseola and [19] Gomez A., Snell T.W., Sibling species and cryptic speciation in the
Brachionus calyciflorus (Rotifers), I- The buccal velum, in: Dumont H.J., rotifer Brachionus plicatilis species complex (Rotifera), J. Evol. Biol. 9
Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Dr W, Junk (1996) 953–964.
Publishers, The Hague, 1980, pp. 127–131. [20] Raff R.A., Marshall C.R., Turbeville J.M., Using DNA sequences to
[9] Clément P., Amsellem J., Cornillac A.M., Luciani A., Ricci C., unravel the Cambrian radiation of the animal phyla, Annu. Rev. Ecol. Syst.
Ultrastructural approach to feeding behaviour in Philodina roseola and 25 (1994) 351–375.
Brachionus calyciflorus (Rotifers), II- The oesophagus, in: Dumont H.J., [21] Winnepenninckx B., Backeljau T., Mackey L.Y., Brooks J.M., De
Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Dr W, Junk Wachter R., Kumar S., Garey J.R., 18S rRNA data indicate that the
Publishers, The Hague, 1980, pp. 133–136. Aschelminthes are polyphyletic in origin and consist of at least three
[10] Wallace R.L., Colburn R.A., Phylogenetic relationships within distinct clades, Mol. Biol. Evol. 12 (1995) 1132–1137.
phylum Rotifera: orders and genus Notholca, Hydrobiologia 186/187 [22] Conway-Morris S., Crompton D.W.T., The origins and evolution
(1989) 311–318. of Acanthocephala, Biol. Rev. 57 (1982) 85–115.
940A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
[23] Amin O.M., Classification, in: Crompton D.W.T., Nickol B.B. [49] Kim J., Kim W., Cunningham C.W., A new perspective on lower
(Eds.), Biology of the Acanthocephala, Cambridge University Press, Cam- Metazoan relationships from 18S rDNA sequences, Mol. Biol. Evol. 16 (3)
bridge, 1985, pp. 27–72. (1999) 423–427.
[24] Whitfield P.J., Phylogenetic affinities of Acanthocephala: an assess- [50] Felsenstein J., Evolutionary trees from DNA sequences: a maxi-
ment of ultrastructural evidence, J. Parasitol. 63 (1971) 49–58. mum likelihood approach, J. Mol. Evol. 17 (1981) 368–376.
[25] Storch V., Contributions of comparative ultrastructural research to [51] Olsen G.J., Matsuda H., Hagstrom R., Overbeek R., FastDNAML:
problems of invertebrate evolution, Am. Zool. 19 (1979) 637–645. a tool for construction of phylogenetic trees of DNA sequences using
[26] Clément P., The relationships of rotifers, in: Conway Morris S., maximum likelihood, Comput. Appl. Biosci. 10 (1994) 41–48.
George J.D., Platt H.M. (Eds.), The Origins and Relationships of Lower [52] Farris J.S., Källersjö M., Kluge A., Bult C., Testing significance of
Invertebrates, System. Assoc. Clarendon Press, Oxford, 1985, pp. 224– congruence, Cladistics 10 (1995) 315–320.
247.
[53] Bremer K., The limits of amino acid sequence data in Angiosperm
[27] Lorenzen S., Phylogenetic aspects of pseudocoelomate evolution, phylogenetic reconstitution, Evolution 42 (1988) 795–803.
in: Conway Morris S., George J.D., Platt H.M. (Eds.), The Origins and
Relationships of Lower Invertebrates, System. Assoc. Clarendon Press, [54] Templeton A.R., Convergent evolution and non-parametric infer-
Oxford, 1985. ences from restriction fragment and DNA sequence data, in: Weir B. (Ed.),
Statistical Analysis of DNA Sequence Data, Marcel Dekker, New York,
[28] Ruppert E.E., Introduction to the Aschelminthes phyla: a consid-
1983, pp. 151–179.
eration of mesoderm, body cavities and cuticle, in: Harrison F.W., Ruppert
E.E. (Eds.), Microscopic Anatomy of Invertebrates, Vol.4: Aschelminthes, [55] Kishino H., Hasegawa M., Evaluation of the maximum likelihood
Wiley-Liss Inc., 1991, pp. 1–17. estimate of the evolutionary tree topologies from DNA sequence data, and
the branching order of the Hominoidea, J. Mol. Evol. 29 (1989) 170–179.
[29] Schram F.R., Ellis W.N., Metazoan relationships: a rebutal, Cladis-
tics 10 (1994) 331–337. [56] Kumar S., PHYLTEST: a program for testing phylogenetic hypoth-
[30] Nielsen C., Animal Evolution, Oxford University Press, 1995. eses, Pennsylvania State University, University Park, PA, 1996.
[31] Nielsen C., Scharff N., Eibye-Jacobsen D., Cladistic analyses of the [57] Vawter L., Brown W.M., Rates and patterns of base change in the
animal kingdom, Biol. J Linn. Soc. 57 (1996) 385–410. small subunit ribosomal RNA gene, Genetics 134 (1993) 597–608.
[32] Garey J.R., Near T.J., Nonnemacher M.R., Nadler S.A., Molecular [58] Conway-Morris S., Non-skeletalized lower invertebrate fossils: a
evidence for Acanthocephala as a subtaxon of Rotifera, J. Mol. Evol. 43 review, in: Conway Morris S., George J.D., Platt H.M. (Eds.), The Origin
(1996) 287–292. and Relationships of Lower Invertebrates, System. Assoc. Clarendon
[33] Zrzavy J., Mihulka S., Kepka P., Bezdek A., Phylogeny of the Press, Oxford, 1985, pp. 343–359.
Metazoa based on morphological and 18S ribosomal DNA evidence, [59] Warner B.G., Chengalath R., Holocene fossil Habrotrocha angus-
Cladistics 14 (1998) 249–285. ticollis (Bdelloidea: Rotifera) in North America, J. Paleolimnol. 1 (1988)
[34] Abouheif E., Zardoya R., Meyer A., Limitations of Metazoan 18S 141–147.
rRNA sequence data: Implications for reconstructing a phylogeny of the [60] Waggoner B.M., Poinar G.O., Fossil Habrotrochid rotifers in
animal kingdom and inferring the reality of the Cambrian explosion, Dominican amber, Experientia 49 (1993) 354–357.
J. Mol. Evol. 47 (1998) 394–405. [61] Birky C.W., Studies on the physiology and genetics of the rotifer
[35] Garey J.R., Schmidt-Rhaesa A., Near T.J., Nadler S.A., The evolu- Asplanchna, III, Results of outcrossing, selfing, and selection, J. Exp. Zool.
tionary relationships of Rotifers and Acanthocephalans, Hydrobiologia 165 (1967) 104–116.
387/388 (1998) 83–91. [62] King C.E., Genetics of reproduction, variation, and adaptation in
[36] Near T.J., Garey J.R., Nadler S.A., Phylogenetic relationships of rotifers, Arch. Hydrobiol. Beih. 8 (1977) 187–201.
the Acanthocephala inferred from 18S ribosomal DNA sequences, Mol.
[63] Pejler B., Variation in the genus Keratella, Hydrobiologia 73
Phyl. Evol. 10 (3) (1998) 287–298.
(1980) 207–213.
[37] Winnepenninckx B., Backeljau T., Kristensen R.M., Relations of
the new phylum Cycliophora, Nature 393 (1998) 636–638. [64] De Beauchamp P.M., Recherches sur les rotifères : les formations
tégumentaires et l’appareil digestif, Arch. Zool. Exp. Gen. 10 (1909)
[38] Koste W., Rotatoria, Die Rädertiee Citteleuropas, 2 vols, Gebrüder 1–410.
Borntraeger, Berlin, 1978.
[65] Pawlowski J., Bolivar I., Fahrni J.F., de Vargas C., Gouy M.,
[39] King C.E., Snell T.W., Sexual recombination in rotifers, Heredity
Zaninetti L., Extreme differences in rates of molecular evolution of fora-
39 (1977) 357–360.
minifera revealed by comparison of ribosomal DNA sequences and the
[40] Starkweather P.L., Gilbert J.J., Radiotracer determination of feed- fossil, Mol. Biol. Evol. 14 (1997) 498–505.
ing in Brachionus calyciflorus: influence of gut passage times, Arch.
[66] Philippe H., Laurent J., How good are deep phylogenetic trees?
Hydrobiol. Beih. Ergebn. Limnol. 8 (1977) 261–263.
Curr. Opin. Genet. Dev. 8 (6) (1998) 616–623.
[41] Taberlet P., Bouvet J., A single plucked feather as a source of DNA
for bird genetic studies, The AUK 108 (1991) 58. [67] Brinkmann H., Philippe H., Archaea sister group of bacteria?
Indications from tree reconstruction artifacts in ancient phylogenies, Mol.
[42] Philippe H., MUST: a computer package of management utilities Biol. Evol. 16 (6) (1999) 817–825.
for sequences and trees, Nucleic Acids Res. 21 (1993) 5264–5272.
[68] Philippe H., Chenuil A., Adoutte A., Can the Cambrian explosion
[43] Van de Peer Y., Caers A., De Rijk P., De Wachter R., Database on
be inferred through molecular phylogeny? Development Suppl., 1994,
the structure of small ribosomal subunit RNA, Nucleic Acids Res. 26
pp. 15–25.
(1998) 179–182.
[44] De Rijk P., De Wachter R., RnaViz, a program for the visualisation [69] Telford M.J., Holland P.W.H., The phylogenetic affinities of the
of RNA secondary structure, Nucleic Acids Res. 25 (1997) 4679–4684. Chaetognaths: a molecular analysis, Mol. Biol. Evol. 10 (1993) 660–676.
[45] Saitou N., Nei M., The neighbor-joining method: a new method [70] Adoutte A., Balavoine G., Lartillot N., de Rosa R., Animal evolu-
for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406–425. tion - the end of the intermediate taxa? Trends Genet. 15 (3) (1999)
104–108.
[46] Jukes T.H., Cantor C.R., Evolution of protein molecules, in:
Munro H.H. (Ed.), Mammalian Protein Metabolism, Academic Press, New [71] De Rosa R., Grenier J.K., Andreeva T., Cook C.E., Adoutte A.,
York, 1969, pp. 21–132. Akam M., Carroll S.B., Balavoine G., Hox genes in brachiopods and
priapulids and protostome evolution, Nature 399 (1999) 772–776.
[47] Kumar S., Tamura K., Nei M., MEGA: Molecular Evolutionary
Genetics Analysis, Pennsylvania State University, University Park, PA, [72] Yang Z., Kumar S., Approximate methods for estimating the pat-
1993. tern of nucleotide substitution rates among sites, Mol. Biol. Evol. 13
[48] Cunningham C.W., Zhu H., Hillis D.M., Best-fit maximum likeli- (1996) 650–659.
hood models for phylogenetic inference: empirical tests with known [73] Takezaki N., Rzhetsky A., Nei M., Phylogenetic test of the molecu-
phylogenies, Evolution 52 (1998) 978–987. lar clock and linearized trees, Mol. Biol. Evol. (12) 5 (1995) 823–833.
941Vous pouvez aussi lire
